crop seq car vectors (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
crop seq car vectors
Crop Seq Car Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crop+seq+guide+puro+vector/CROPseq-Guide-Puro+(Plasmid+%2386708)/pmc12545207-236-1-9
Average 96 stars, based on 124 article reviews
Crop Seq Car Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crop+seq+guide+puro+vector/CROPseq-Guide-Puro+(Plasmid+%2386708)/pmc12545207-236-1-9
Average 96 stars, based on 124 article reviews
crop seq car vectors - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution. Article Snippet: .. CROP-mCherry vector and library cloning The puromycin resistance cassette in the original Article Title: GiRAFR improves gRNA detection and annotation in single-cell CRISPR screens. Article Snippet: We designed four different gRNAs for each of 25 target genes, and 20 non-targeting guides as controls using Benchling [Biology Software, 2018], retrieved from https:// benchling.com. .. Final gRNA sequences contained homology arms (5′-end: TGGAAAGGACGAAACACCG, 3′-end: GTTTT AGAGCTAGAAATAGCAAGTTAAAATAAGGC) to allow for cloning into the Article Title: GiRAFR improves gRNA detection and annotation in single-cell CRISPR screens Article Snippet: We designed four different gRNAs for each of 25 target genes, and 20 non-targeting guides as controls using Benchling [Biology Software, 2018], retrieved from https://benchling.com . .. Final gRNA sequences contained homology arms (5′-end: TGGAAAGGACGAAACACCG, 3′-end: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC) to allow for cloning into the Article Title: Expressed barcodes enable clonal characterization of chemotherapeutic responses in chronic lymphocytic leukemia Article Snippet: Cells were routinely tested for mycoplasma per the manufacturer’s instructions (VenorGeM Mycoplasma Detection Kit; Sigma-Aldrich #MP0025). .. The Cloning:Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution. Article Snippet: .. CROP-mCherry vector and library cloning The puromycin resistance cassette in the original Article Title: GiRAFR improves gRNA detection and annotation in single-cell CRISPR screens. Article Snippet: We designed four different gRNAs for each of 25 target genes, and 20 non-targeting guides as controls using Benchling [Biology Software, 2018], retrieved from https:// benchling.com. .. Final gRNA sequences contained homology arms (5′-end: TGGAAAGGACGAAACACCG, 3′-end: GTTTT AGAGCTAGAAATAGCAAGTTAAAATAAGGC) to allow for cloning into the Article Title: GiRAFR improves gRNA detection and annotation in single-cell CRISPR screens Article Snippet: We designed four different gRNAs for each of 25 target genes, and 20 non-targeting guides as controls using Benchling [Biology Software, 2018], retrieved from https://benchling.com . .. Final gRNA sequences contained homology arms (5′-end: TGGAAAGGACGAAACACCG, 3′-end: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC) to allow for cloning into the Sequencing:Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution. Article Snippet: .. CROP-mCherry vector and library cloning The puromycin resistance cassette in the original Article Title: In vivo single-cell CRISPR screening for microproteins identifies a critical ribosomal component Article Snippet: .. The puromycin resistance cassette in the original Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution Article Snippet: .. The puromycin resistance cassette in the original Article Title: In vivo single-cell ribosome profiling reveals cell-type-specific translational programs during aging Article Snippet: .. The ampicillin resistance cassette in the original Amplification:Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution. Article Snippet: .. CROP-mCherry vector and library cloning The puromycin resistance cassette in the original Article Title: In vivo single-cell CRISPR screening for microproteins identifies a critical ribosomal component Article Snippet: .. The puromycin resistance cassette in the original Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution Article Snippet: .. The puromycin resistance cassette in the original Article Title: In vivo single-cell ribosome profiling reveals cell-type-specific translational programs during aging Article Snippet: .. The ampicillin resistance cassette in the original Clone Assay:Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution. Article Snippet: .. CROP-mCherry vector and library cloning The puromycin resistance cassette in the original Article Title: In vivo single-cell CRISPR screening for microproteins identifies a critical ribosomal component Article Snippet: .. The puromycin resistance cassette in the original Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution Article Snippet: .. The puromycin resistance cassette in the original Article Title: In vivo single-cell ribosome profiling reveals cell-type-specific translational programs during aging Article Snippet: .. The ampicillin resistance cassette in the original FACS:Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution. Article Snippet: .. CROP-mCherry vector and library cloning The puromycin resistance cassette in the original Article Title: In vivo single-cell CRISPR uncovers distinct TNF programmes in tumour evolution Article Snippet: .. The puromycin resistance cassette in the original Modification:Article Title: Expressed barcodes enable clonal characterization of chemotherapeutic responses in chronic lymphocytic leukemia Article Snippet: Cells were routinely tested for mycoplasma per the manufacturer’s instructions (VenorGeM Mycoplasma Detection Kit; Sigma-Aldrich #MP0025). .. The |